Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 2467150
End position: 2467173
Length: 24

DNA sequence
>NC_010508, from 2467150 to 2467173 (24 bp); Burkholderia cenocepacia MC0-3 chromosome 1 CTGCCGCTGCCCCCGCCGATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2466577-2469360	Sequence	Bcenmc03_2206 - ImpA family type VI secretion-associated protein (Protein is coded in complementary strand; from 2469360 to 2466577)