Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 264758
End position: 264802
Length: 45

DNA sequence
>NC_010508, from 264758 to 264802 (45 bp); Burkholderia cenocepacia MC0-3 chromosome 1 CGCGCCGCCGCCGGCCGCGCCGCAACCGGCTGCTCCGGCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 263896-266148	Sequence	Bcenmc03_0238 - CheA signal transduction histidine kinase