Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 2767668
End position: 2767692
Length: 25

DNA sequence
>NC_010508, from 2767668 to 2767692 (25 bp); Burkholderia cenocepacia MC0-3 chromosome 1 ACGCGACGCTGCGCGACACGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2767337-2768086	Sequence	Bcenmc03_2475 - uroporphyrin-III C-methyltransferase (Protein is coded in complementary strand; from 2768086 to 2767337)