Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 2913526
End position: 2913549
Length: 24

DNA sequence
>NC_010508, from 2913526 to 2913549 (24 bp); Burkholderia cenocepacia MC0-3 chromosome 1 AATCCGAGTCCGAAACCGAATCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2913313-2914509	Sequence	Bcenmc03_2613 - beta-lactamase (Protein is coded in complementary strand; from 2914509 to 2913313)