Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 3371494
End position: 3371517
Length: 24

DNA sequence
>NC_010508, from 3371494 to 3371517 (24 bp); Burkholderia cenocepacia MC0-3 chromosome 1 ATCGCGTTCGCGAGCGCGGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3371224-3372459	Sequence	Bcenmc03_3033 flgL flagellar hook-associated protein FlgL (Protein is coded in complementary strand; from 3372459 to 3371224)