Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 571223
End position: 571249
Length: 27

DNA sequence
>NC_010508, from 571223 to 571249 (27 bp); Burkholderia cenocepacia MC0-3 chromosome 1 AACGCACGCAACGCACGCAACGCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 569552-571225	Sequence	Bcenmc03_0518 - long-chain-fatty-acid--CoA ligase