Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 698893
End position: 698922
Length: 30

DNA sequence
>NC_010508, from 698893 to 698922 (30 bp); Burkholderia cenocepacia MC0-3 chromosome 1 CACGGGTGCGCGCGTGTGCGAACAGGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 698532-699272	Sequence	Bcenmc03_0637 - polar amino acid ABC transporter inner membrane subunit