Sequence retrieval

Genome: Akkermansia muciniphila ATCC BAA-835
Start position: 1934735
End position: 1934758
Length: 24

DNA sequence
>NC_010655, from 1934735 to 1934758 (24 bp); Akkermansia muciniphila ATCC BAA-835 AGACGAAGAAGAAGGCGAAGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1934611-1935879	Sequence	Amuc_1610 - NADH dehydrogenase (quinone) (Protein is coded in complementary strand; from 1935879 to 1934611)