Sequence retrieval

Genome: Akkermansia muciniphila ATCC BAA-835
Start position: 1773255
End position: 1773281
Length: 27

DNA sequence
>NC_010655, from 1773255 to 1773281 (27 bp); Akkermansia muciniphila ATCC BAA-835 CAGCAGGAGAAGCAGGAGAAGCAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1772177-1773292	Sequence	Amuc_1482 - hypothetical protein (Protein is coded in complementary strand; from 1773292 to 1772177)