Sequence retrieval

Genome: Akkermansia muciniphila ATCC BAA-835
Start position: 1335045
End position: 1335080
Length: 36

DNA sequence
>NC_010655, from 1335045 to 1335080 (36 bp); Akkermansia muciniphila ATCC BAA-835 CGGCAGGAGCGGAGGCAGGAGCGGAGGCAGGAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1334351-1335268	Sequence	Amuc_1116 - phage SPO1 DNA polymerase-related protein (Protein is coded in complementary strand; from 1335268 to 1334351)