Sequence retrieval

Genome: Akkermansia muciniphila ATCC BAA-835
Start position: 2164743
End position: 2164790
Length: 48

DNA sequence
>NC_010655, from 2164743 to 2164790 (48 bp); Akkermansia muciniphila ATCC BAA-835 TTATCCTTGTCTTGGTCCTTGTCTTGGTCCTTGTCTTGGTCCTTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2164464-2166728	Sequence	Amuc_1777 - von Willebrand factor type A (Protein is coded in complementary strand; from 2166728 to 2164464)