Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 1097871
End position: 1097894
Length: 24

DNA sequence
>NC_010803, from 1097871 to 1097894 (24 bp); Chlorobium limicola DSM 245 TCCTGCTCCTGTTTCTGCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1097829-1099019	Sequence	Clim_1006 - iron complex transport system substrate-binding protein