Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 2730885
End position: 2730908
Length: 24

DNA sequence
>NC_010803, from 2730885 to 2730908 (24 bp); Chlorobium limicola DSM 245 TTCTTTTTCTGTTTGTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2730876-2731295	Sequence	Clim_2492 - hypothetical protein (Protein is coded in complementary strand; from 2731295 to 2730876)