Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 1194157
End position: 1194183
Length: 27

DNA sequence
>NC_010803, from 1194157 to 1194183 (27 bp); Chlorobium limicola DSM 245 GGCTCCGGCGGCTCCGGCGGCTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1193786-1194280	Sequence	Clim_1089 - hypothetical protein (Protein is coded in complementary strand; from 1194280 to 1193786)