Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 2698547
End position: 2698579
Length: 33

DNA sequence
>NC_010803, from 2698547 to 2698579 (33 bp); Chlorobium limicola DSM 245 GGGGTACATGTGCGGTACATGTGCGGTACATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2698302-2699744	Sequence	Clim_2462 - transcriptional regulator (Protein is coded in complementary strand; from 2699744 to 2698302)