Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 2053232
End position: 2053266
Length: 35

DNA sequence
>NC_010803, from 2053232 to 2053266 (35 bp); Chlorobium limicola DSM 245 CTCATTGCTCATTGCTCATTGCTCATTGCTCATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2051888-2053237	Sequence	Clim_1867 - hypothetical protein (Protein is coded in complementary strand; from 2053237 to 2051888)