Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 2124120
End position: 2124155
Length: 36

DNA sequence
>NC_010803, from 2124120 to 2124155 (36 bp); Chlorobium limicola DSM 245 TTGTCCGATGCGTTGTCCGATGCGTTGTCCGATGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2123973-2124278	Sequence	Clim_1920 - hypothetical protein (Protein is coded in complementary strand; from 2124278 to 2123973)