Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 583805
End position: 583840
Length: 36

DNA sequence
>NC_010803, from 583805 to 583840 (36 bp); Chlorobium limicola DSM 245 AGCACCTGCCGAAGCTCCTGCTGAAGCACCTGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 583661-583810	Sequence	Clim_0516 - hypothetical protein (Protein is coded in complementary strand; from 583810 to 583661)