Sequence retrieval

Genome: Chlorobium limicola DSM 245
Start position: 1572556
End position: 1572615
Length: 60

DNA sequence
>NC_010803, from 1572556 to 1572615 (60 bp); Chlorobium limicola DSM 245 TGACTTGCCCTGTGACTTGCCCTGTGACTTGCCCTGTGACTTGCCCTGTGACTTGCCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1572330-1573856	Sequence	Clim_1467 - transcriptional regulator (Protein is coded in complementary strand; from 1573856 to 1572330)