Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1135306
End position: 1135329
Length: 24

DNA sequence
>NC_010804, from 1135306 to 1135329 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku TCGGCTTCGGTTTCCGCTGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134307-1136100	Sequence	BMULJ_01069 lepA GTP-binding protein LepA