Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1493882
End position: 1493905
Length: 24

DNA sequence
>NC_010804, from 1493882 to 1493905 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku GACGGCGACGGCGGCGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1493517-1493927	Sequence	BMULJ_01380 - hypothetical protein (Protein is coded in complementary strand; from 1493927 to 1493517)