Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1733099
End position: 1733122
Length: 24

DNA sequence
>NC_010804, from 1733099 to 1733122 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGCTCTCGCTCGTGCTCGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1733023-1733775	Sequence	BMULJ_01625 - polar amino acid transporter permease