Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1821285
End position: 1821308
Length: 24

DNA sequence
>NC_010804, from 1821285 to 1821308 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGATCGCGAGCGCGACCGAGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1821215-1822672	Sequence	BMULJ_01693 - major facilitator superfamily permease (Protein is coded in complementary strand; from 1822672 to 1821215)