Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2223618
End position: 2223641
Length: 24

DNA sequence
>NC_010804, from 2223618 to 2223641 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku TCGTCGTCTTCGTCCTCGTCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2223570-2224127	Sequence	BMULJ_02069 slyD FKBP-type peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 2224127 to 2223570)