Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2266950
End position: 2266973
Length: 24

DNA sequence
>NC_010804, from 2266950 to 2266973 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGCGCGAGCGCGCGCTCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2266397-2267119	Sequence	BMULJ_02115 - heterodisulfide reductase (Protein is coded in complementary strand; from 2267119 to 2266397)