Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2440696
End position: 2440719
Length: 24

DNA sequence
>NC_010804, from 2440696 to 2440719 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGATCGCGAACGCGAACGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2439873-2441678	Sequence	BMULJ_02274 kdpA potassium-transporting ATPase subunit A (Protein is coded in complementary strand; from 2441678 to 2439873)