Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 251902
End position: 251925
Length: 24

DNA sequence
>NC_010804, from 251902 to 251925 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGGCGGCGCGGCGCCGCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 250995-251981	Sequence	BMULJ_00240 potB spermidine/putrescine transporter permease (Protein is coded in complementary strand; from 251981 to 250995)