Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2645227
End position: 2645250
Length: 24

DNA sequence
>NC_010804, from 2645227 to 2645250 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGAGCGCGCGCGCGATCTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2644964-2645740	Sequence	BMULJ_02460 livG branched-chain amino acid transporter ATP-binding protein (Protein is coded in complementary strand; from 2645740 to 2644964)