Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2718356
End position: 2718379
Length: 24

DNA sequence
>NC_010804, from 2718356 to 2718379 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGACGACGGCGACGACGACGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2717617-2719134	Sequence	BMULJ_02527 amiA N-acetylmuramoyl-L-alanine amidase