Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 277473
End position: 277496
Length: 24

DNA sequence
>NC_010804, from 277473 to 277496 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGCTCGCGTTCGCGCGCGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 275966-277807	Sequence	BMULJ_00267 - signal transduction GGDEF/EAL domain protein (Protein is coded in complementary strand; from 277807 to 275966)