Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2945348
End position: 2945371
Length: 24

DNA sequence
>NC_010804, from 2945348 to 2945371 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku TCGTCGTCGTCCGCGTCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2945084-2947090	Sequence	BMULJ_02729 - CPA2 family monovalent cation:H+ antiporter-2 (Protein is coded in complementary strand; from 2947090 to 2945084)