Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 2984126
End position: 2984149
Length: 24

DNA sequence
>NC_010804, from 2984126 to 2984149 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku AGCGCGATCGCGCGCGCGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2983967-2984581	Sequence	BMULJ_02762 - putative N6-adenine-specific methylase (Protein is coded in complementary strand; from 2984581 to 2983967)