Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3103726
End position: 3103749
Length: 24

DNA sequence
>NC_010804, from 3103726 to 3103749 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCCGCGGCCGCCGTCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3103710-3105305	Sequence	BMULJ_02873 - peptide/nickel transporter substrate-binding protein