Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3170222
End position: 3170245
Length: 24

DNA sequence
>NC_010804, from 3170222 to 3170245 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CTGCTCCTGCACCTGCTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3169884-3170513	Sequence	BMULJ_02933 - putative ABC transporter auxiliary component (Protein is coded in complementary strand; from 3170513 to 3169884)