Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3173325
End position: 3173348
Length: 24

DNA sequence
>NC_010804, from 3173325 to 3173348 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGAGCGCGATCGCGCGCGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3172991-3173812	Sequence	BMULJ_02937 - putative ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 3173812 to 3172991)