Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3181674
End position: 3181697
Length: 24

DNA sequence
>NC_010804, from 3181674 to 3181697 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku TCGCTGTCGCAGTCGATGTCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3180553-3181815	Sequence	BMULJ_02944 - major facilitator superfamily permease