Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3330026
End position: 3330049
Length: 24

DNA sequence
>NC_010804, from 3330026 to 3330049 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCCGTCGCCATCGCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3328834-3330129	Sequence	BMULJ_03090 - Gly/Ala/Ser-rich lipoprotein (Protein is coded in complementary strand; from 3330129 to 3328834)