Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 721416
End position: 721439
Length: 24

DNA sequence
>NC_010804, from 721416 to 721439 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku TCGTCGTCTTCGTCGCCGTGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 721189-722025	Sequence	BMULJ_00661 pilW type IV pilus assembly protein