Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 97914
End position: 97937
Length: 24

DNA sequence
>NC_010804, from 97914 to 97937 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGAGCGCGCGTGCGAGCGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 97273-98364	Sequence	BMULJ_00093 potA spermidine/putrescine transporter ATP-binding protein (Protein is coded in complementary strand; from 98364 to 97273)