Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 981953
End position: 981976
Length: 24

DNA sequence
>NC_010804, from 981953 to 981976 (24 bp); Burkholderia multivorans ATCC 17616 Tohoku CTGCCATTGCCACTGCCACTGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 980126-982123	Sequence	BMULJ_00906 traI relaxase (Protein is coded in complementary strand; from 982123 to 980126)