Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1064693
End position: 1064717
Length: 25

DNA sequence
>NC_010804, from 1064693 to 1064717 (25 bp); Burkholderia multivorans ATCC 17616 Tohoku GCGCGGCACGTCGCGGCCCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1064280-1065188	Sequence	BMULJ_00993 - acylglycerol lipase (Protein is coded in complementary strand; from 1065188 to 1064280)