Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1349260
End position: 1349284
Length: 25

DNA sequence
>NC_010804, from 1349260 to 1349284 (25 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGGCACGGCTCGGCGCGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1348575-1349450	Sequence	BMULJ_01266 tas2 putative oxidoreductase