Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1865338
End position: 1865362
Length: 25

DNA sequence
>NC_010804, from 1865338 to 1865362 (25 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCCGCGCAGCGCGGCGGCGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1865193-1866383	Sequence	BMULJ_01736 - 2-nitropropane dioxygenase (Protein is coded in complementary strand; from 1866383 to 1865193)