Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 210171
End position: 210195
Length: 25

DNA sequence
>NC_010804, from 210171 to 210195 (25 bp); Burkholderia multivorans ATCC 17616 Tohoku GGCGCGGCACGGTGCGGCGCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 209981-210637	Sequence	BMULJ_00200 kipI inhibitor of KinA (Protein is coded in complementary strand; from 210637 to 209981)