Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 3293772
End position: 3293796
Length: 25

DNA sequence
>NC_010804, from 3293772 to 3293796 (25 bp); Burkholderia multivorans ATCC 17616 Tohoku CGCGCTGCGCCGCACCGCGGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3293342-3294544	Sequence	BMULJ_03056 - HlyD family secretion protein