Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1091464
End position: 1091490
Length: 27

DNA sequence
>NC_010804, from 1091464 to 1091490 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CCGTTCGGTCCGTTCGATGCGTTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1090687-1093275	Sequence	BMULJ_01022 - putative proline-rich exported protein (Protein is coded in complementary strand; from 1093275 to 1090687)