Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1096026
End position: 1096052
Length: 27

DNA sequence
>NC_010804, from 1096026 to 1096052 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku GCGCGCAGCGTGCGCAGCGCGGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1095141-1096535	Sequence	BMULJ_01026 fumC fumarate hydratase (Protein is coded in complementary strand; from 1096535 to 1095141)