Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1114871
End position: 1114897
Length: 27

DNA sequence
>NC_010804, from 1114871 to 1114897 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku GCCGCGACGGCCGCGGCGGCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1114083-1117247	Sequence	BMULJ_01048 - ribonuclease (Protein is coded in complementary strand; from 1117247 to 1114083)