Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1155440
End position: 1155466
Length: 27

DNA sequence
>NC_010804, from 1155440 to 1155466 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku CAGTGCGGTCAGTGCGGCTAGTGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1155467-1156336	Sequence	BMULJ_01094 - hypothetical protein (Protein is coded in complementary strand; from 1156336 to 1155467)