Sequence retrieval

Genome: Burkholderia multivorans ATCC 17616 Tohoku
Start position: 1403266
End position: 1403292
Length: 27

DNA sequence
>NC_010804, from 1403266 to 1403292 (27 bp); Burkholderia multivorans ATCC 17616 Tohoku GCGCGAACGGCGCGAACGGCGCGAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1402807-1405398	Sequence	BMULJ_01307 - iron complex outer membrane receptor protein